Variant: rs1135401727 

    present in Gene: INS-IGF2;INS
    present in Chromosome: 11
    Position on Chromosome: 2161314
    Alleles of this Variant: GATGGCTGGGGGCTGAGGCTGCAA/-

rs1135401727 in INS-IGF2;INS gene and DIABETES MELLITUS, PERMANENT NEONATAL PMID 20133622 2010 Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis.

PMID 20938745 2010 Clinical and molecular genetics of neonatal diabetes due to mutations in the insulin gene.