Variant: rs113899791

present in Gene: IRF8 present in Chromosome: 16 Position on Chromosome: 85902784 Alleles of this Variant: GGCTGCAGGT/-;GGCTGCAGGTGGCTGCAGGT;GGCTGCAGGTGGCTGCAGGTGGCTGCAGGT

rs113899791 in IRF8 gene and Monocyte count procedure PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs113899791 in IRF8 gene and Monocyte count result PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.