Variant: rs1329070853 

    present in Gene: ASL
    present in Chromosome: 7
    Position on Chromosome: 66089677
    Alleles of this Variant: GTCATCTCTACGCTGCAGGCAAGAC/-

rs1329070853 in ASL gene and Argininosuccinic Aciduria PMID 16941645 2006 Deletion hotspot in the argininosuccinate lyase gene: association with topoisomerase II and DNA polymerase alpha sites.

PMID 24166829 2014 Mutations and polymorphisms in the human argininosuccinate lyase (ASL) gene.