Variant: rs1341894581 

    present in Gene: ECEL1
    present in Chromosome: 2
    Position on Chromosome: 232486499
    Alleles of this Variant: ACCGGGCCCCGGTGGCGCTGCGCGCAGCGCCCAACGGGAAGCCCGG/-

rs1341894581 in ECEL1 gene and Dysmorphic features PMID 25708584 2015 ECEL1 mutation causes fetal arthrogryposis multiplex congenita.

PMID 23261301 2013 Mutations in ECEL1 cause distal arthrogryposis type 5D.

PMID 24782201 2014 Distal arthrogryposis type 5D with novel clinical features and compound heterozygous mutations in ECEL1.

PMID 23236030 2013 The neuronal endopeptidase ECEL1 is associated with a distinct form of recessive distal arthrogryposis.

PMID 25099528 2014 Distal arthrogryposis type 5D with a novel ECEL1 gene mutation.

rs1341894581 in ECEL1 gene and Multiple congenital anomalies PMID 25099528 2014 Distal arthrogryposis type 5D with a novel ECEL1 gene mutation.

PMID 23236030 2013 The neuronal endopeptidase ECEL1 is associated with a distinct form of recessive distal arthrogryposis.

PMID 23261301 2013 Mutations in ECEL1 cause distal arthrogryposis type 5D.

PMID 24782201 2014 Distal arthrogryposis type 5D with novel clinical features and compound heterozygous mutations in ECEL1.

PMID 25708584 2015 ECEL1 mutation causes fetal arthrogryposis multiplex congenita.