present in Gene: TSC2;PKD1
present in Chromosome: 16
Position on Chromosome: 2088293
Alleles of this Variant: CATCAAGCGGCTCCGCCA/-;CATCAAGCGGCTCCGCCACATCAAGCGGCTCCGCCA
PMID 21309039 2011 Functional assessment of variants in the TSC1 and TSC2 genes identified in individuals with Tuberous Sclerosis Complex.
PMID 22867869 2013 Central TSC2 missense mutations are associated with a reduced risk of infantile spasms.
PMID 17304050 2007 Genotype/phenotype correlation in 325 individuals referred for a diagnosis of tuberous sclerosis complex in the United States.
PMID 15798777 2005 Mutational analysis of the TSC1 and TSC2 genes in a diagnostic setting: genotype--phenotype correlations and comparison of diagnostic DNA techniques in Tuberous Sclerosis Complex.
PMID 11112665 2001 Mutational analysis in a cohort of 224 tuberous sclerosis patients indicates increased severity of TSC2, compared with TSC1, disease in multiple organs.
PMID 10205261 1999 Comprehensive mutation analysis of TSC1 and TSC2-and phenotypic correlations in 150 families with tuberous sclerosis.
rs137854218 in
TSC2;PKD1 gene and
TUBEROUS SCLEROSIS 2 (disorder)
PMID 21309039 2011 Functional assessment of variants in the TSC1 and TSC2 genes identified in individuals with Tuberous Sclerosis Complex.
PMID 9829910 1998 Exon scanning of the entire TSC2 gene for germline mutations in 40 unrelated patients with tuberous sclerosis.
PMID 10205261 1999 Comprehensive mutation analysis of TSC1 and TSC2-and phenotypic correlations in 150 families with tuberous sclerosis.
PMID 15874888 2005 Clinical symptoms of tuberous sclerosis complex in patients with an identical TSC2 mutation.
PMID 22867869 2013 Central TSC2 missense mutations are associated with a reduced risk of infantile spasms.
PMID 15024740 2004 Novel TSC2 mutations and decreased expression of tuberin in cultured tumor cells with an insertion mutation.