Variant: rs146318841

present in Gene: AHI1 present in Chromosome: 6 Position on Chromosome: 135328483 Alleles of this Variant: TGCCATAAACCATAGCCATAG/-;TGCCATAAACCATAGCCATAGTGCCATAAACCATAGCCATAG

rs146318841 in AHI1 gene and Blood basophil count (lab test) PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs146318841 in AHI1 gene and Granulocyte count PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs146318841 in AHI1 gene and Neutrophil count (procedure) PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs146318841 in AHI1 gene and White Blood Cell Count procedure PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.