Variant: rs1555280334

present in Gene: BRCA2 present in Chromosome: 13 Position on Chromosome: 32319090 Alleles of this Variant: AAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAAC/-

rs1555280334 in BRCA2 gene and Ovarian Serous Surface Papillary Adenocarcinoma PMID 18704680 2009 BRCA1 and BRCA2 mutation carriers in the Breast Cancer Family Registry: an open resource for collaborative research.

PMID 16793542 2006 Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2.