Variant: rs1555935486

present in Gene: MAP3K15;PDHA1 present in Chromosome: X Position on Chromosome: 19359529 Alleles of this Variant: -/CCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCG

rs1555935486 in MAP3K15;PDHA1 gene and Pyruvate Dehydrogenase Complex Deficiency Disease PMID 21914562 2011 Molecular characterization of 82 patients with pyruvate dehydrogenase complex deficiency. Structural implications of novel amino acid substitutions in E1 protein.