Variant: rs1568702458

present in Gene: PRKAR1A;FAM20A present in Chromosome: 17 Position on Chromosome: 68529891 Alleles of this Variant: TTAGCTTTTTGGTGATTTTATTATAGGGGTCAGCTGCTGT/-

rs1568702458 in PRKAR1A;FAM20A gene and Carney Complex, Type 1 PMID 11115848 2000 Genetic heterogeneity and spectrum of mutations of the PRKAR1A gene in patients with the carney complex.

PMID 19293268 2009 Mutations in regulatory subunit type 1A of cyclic adenosine 5'-monophosphate-dependent protein kinase (PRKAR1A): phenotype analysis in 353 patients and 80 different genotypes.