Variant: rs200855945

present in Gene: SSPN;BHLHE41 present in Chromosome: 12 Position on Chromosome: 26124961 Alleles of this Variant: ACACGCACAC/-;ACACGCACACACACGCACAC

rs200855945 in SSPN;BHLHE41 gene and Major Depressive Disorder PMID 27622933 2016 Analysis of 23andMe antidepressant efficacy survey data: implication of circadian rhythm and neuroplasticity in bupropion response.

rs200855945 in SSPN;BHLHE41 gene and Mood Disorders PMID 27622933 2016 Analysis of 23andMe antidepressant efficacy survey data: implication of circadian rhythm and neuroplasticity in bupropion response.

rs200855945 in SSPN;BHLHE41 gene and Unipolar Depression PMID 27622933 2016 Analysis of 23andMe antidepressant efficacy survey data: implication of circadian rhythm and neuroplasticity in bupropion response.