Variant: rs386834043 

    present in Gene: MKS1
    present in Chromosome: 17
    Position on Chromosome: 58206553
    Alleles of this Variant: ATGCCATTGGGACAGCCTCAGGTTTCTGC/-

rs386834043 in MKS1 gene and Familial aplasia of the vermis PMID 17377820 2007 Molecular diagnostics of Meckel-Gruber syndrome highlights phenotypic differences between MKS1 and MKS3.

PMID 16415886 2006 MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome.

PMID 17397051 2007 Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online.

PMID 17935508 2007 A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome.

PMID 17437276 2007 Aberrant splicing is a common mutational mechanism in MKS1, a key player in Meckel-Gruber syndrome.

PMID 27377014 2016 MKS1 mutations cause Joubert syndrome with agenesis of the corpus callosum.

rs386834043 in MKS1 gene and JOUBERT SYNDROME 28 PMID 16415886 2006 MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome.

PMID 23351400 2012 Founder mutations and genotype-phenotype correlations in Meckel-Gruber syndrome and associated ciliopathies.

rs386834043 in MKS1 gene and Meckel-Gruber syndrome PMID 17377820 2007 Molecular diagnostics of Meckel-Gruber syndrome highlights phenotypic differences between MKS1 and MKS3.

PMID 17935508 2007 A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome.

PMID 17437276 2007 Aberrant splicing is a common mutational mechanism in MKS1, a key player in Meckel-Gruber syndrome.

PMID 16415886 2006 MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome.

PMID 17397051 2007 Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online.