Variant: rs398124542 

    present in Gene: FLCN
    present in Chromosome: 17
    Position on Chromosome: 17219126
    Alleles of this Variant: -/GTACTCTCTGGCAACACAGGGGCTTTCT

rs398124542 in FLCN gene and Multiple fibrofolliculomas PMID 26402642 2016 Capture-based high-coverage NGS: a powerful tool to uncover a wide spectrum of mutation types.

PMID 12204536 2002 Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dubé syndrome.

PMID 19802896 2010 A new locus-specific database (LSDB) for mutations in the folliculin (FLCN) gene.

rs398124542 in FLCN gene and Neoplastic Syndromes, Hereditary PMID 21506000 2011 Abstracts of the Third Birt-Hogg-Dubé Symposium. Maastricht, The Netherlands. May 11-12th, 2011.

PMID 26402642 2016 Capture-based high-coverage NGS: a powerful tool to uncover a wide spectrum of mutation types.

rs398124542 in FLCN gene and PNEUMOTHORAX, PRIMARY SPONTANEOUS PMID 15852235 2005 Germline BHD-mutation spectrum and phenotype analysis of a large cohort of families with Birt-Hogg-Dubé syndrome.