Variant: rs6145546

present in Gene: GATM present in Chromosome: 15 Position on Chromosome: 45376406 Alleles of this Variant: CTCTTCAGGAAG/-;CTCTTCAGGAAGCTCTTCAGGAAG

rs6145546 in GATM gene and Diabetes PMID 31451708 2019 Mapping eGFR loci to the renal transcriptome and phenome in the VA Million Veteran Program.

rs6145546 in GATM gene and Diabetes Mellitus PMID 31451708 2019 Mapping eGFR loci to the renal transcriptome and phenome in the VA Million Veteran Program.

rs6145546 in GATM gene and Glomerular Filtration Rate PMID 31451708 2019 Mapping eGFR loci to the renal transcriptome and phenome in the VA Million Veteran Program.