Variant: rs6147862

present in Gene: LRIG1 present in Chromosome: 3 Position on Chromosome: 66402550 Alleles of this Variant: GCATGGTGGGAAGGACCCAAGGT/-;GCATGGTGGGAAGGACCCAAGGTGCATGGTGGGAAGGACCCAAGGT

rs6147862 in LRIG1 gene and Finding of Mean Corpuscular Hemoglobin PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs6147862 in LRIG1 gene and Mean Corpuscular Volume (result) PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.