Variant: rs61752992 

    present in Gene: MECP2
    present in Chromosome: X
    Position on Chromosome: 154030621
    Alleles of this Variant: TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGC/-

rs61752992 in MECP2 gene and ENCEPHALOPATHY, NEONATAL SEVERE, DUE TO MECP2 MUTATIONS PMID 17089071 2007 MECP2 and CDKL5 gene mutation analysis in Chinese patients with Rett syndrome.

PMID 19914908 2010 Updating the profile of C-terminal MECP2 deletions in Rett syndrome.

PMID 21982064 2012 MECP2 mutations and clinical correlations in Greek children with Rett syndrome and associated neurodevelopmental disorders.

PMID 20151026 2009 Variable phenotypic expression of a MECP2 mutation in a family.

PMID 17387578 2007 Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

rs61752992 in MECP2 gene and Overgrowth PMID 23421866 2013 Using a large international sample to investigate epilepsy in Rett syndrome.

PMID 8177735 1993 Dissection of the methyl-CpG binding domain from the chromosomal protein MeCP2.

PMID 16169931 2006 Chromosomal copy number changes in patients with non-syndromic X linked mental retardation detected by array CGH.

PMID 24458799 2014 MECP2 duplication: possible cause of severe phenotype in females.

PMID 24399845 2014 Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity in Rett syndrome.

PMID 15057977 2004 Phenotypic manifestations of MECP2 mutations in classical and atypical Rett syndrome.

PMID 27354166 2016 Neurophysiology versus clinical genetics in Rett syndrome: A multicenter study.

PMID 17351020 2007 MECP2 mutations in males.

PMID 18337588 2008 Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome.

PMID 11058114 2000 Functional consequences of Rett syndrome mutations on human MeCP2.

PMID 17267601 2007 Partial rescue of MeCP2 deficiency by postnatal activation of MeCP2.

PMID 10508514 1999 Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.

PMID 16832102 2006 Early progressive encephalopathy in boys and MECP2 mutations.

PMID 21154482 2010 Rett syndrome: revised diagnostic criteria and nomenclature.

PMID 11227330 2001 Epilepsy in a representative series of Rett syndrome.

PMID 15558314 2005 Macrocephalic mental retardation associated with a novel C-terminal MECP2 frameshift deletion.

PMID 17236109 2006 Male Rett phenotypes in T158M and R294X MeCP2-mutations.

PMID 11035019 2001 DNA recognition by the methyl-CpG binding domain of MeCP2.

PMID 12615169 2003 Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).