Variant: rs67806247 

    present in Gene: TMEM259
    present in Chromosome: 19
    Position on Chromosome: 1014539
    Alleles of this Variant: TGATGGGGCG/-;TGATGGGGCGTGATGGGGCG

rs67806247 in TMEM259 gene and RDW - Red blood cell distribution width result PMID 28957414 2017 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.

PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs67806247 in TMEM259 gene and Red cell distribution width determination PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

PMID 28957414 2017 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.