Variant: rs727503056

present in Gene: FBN1 present in Chromosome: 15 Position on Chromosome: 48467967 Alleles of this Variant: GTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTTGGA/-

rs727503056 in FBN1 gene and Weill-Marchesani syndrome PMID 12068374 2002 Premature termination mutations in FBN1: distinct effects on differential allelic expression and on protein and clinical phenotypes.

PMID 12525539 2003 In frame fibrillin-1 gene deletion in autosomal dominant Weill-Marchesani syndrome.