Variant: rs756225250

present in Gene: ZIC2 present in Chromosome: 13 Position on Chromosome: 99985449 Alleles of this Variant: AGCGGCGGCGGCGGCTGCGGCGGCGGCGGC/-;AGCGGCGGCGGCGGCTGCGGCGGCGGCGGCAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC

rs756225250 in ZIC2 gene and HOLOPROSENCEPHALY 5 PMID 15590697 2005 In vitro analysis of partial loss-of-function ZIC2 mutations in holoprosencephaly: alanine tract expansion modulates DNA binding and transactivation.

PMID 11285244 2001 Holoprosencephaly due to mutations in ZIC2: alanine tract expansion mutations may be caused by parental somatic recombination.

PMID 19955556 2010 Mutations in ZIC2 in human holoprosencephaly: description of a novel ZIC2 specific phenotype and comprehensive analysis of 157 individuals.

PMID 9771712 1998 Holoprosencephaly due to mutations in ZIC2, a homologue of Drosophila odd-paired.