Variant: rs876657397 

    present in Gene: COL4A3;COL4A4
    present in Chromosome: 2
    Position on Chromosome: 227164756
    Alleles of this Variant: CTGCCGCTCCTGCTGGTGCTCCTG/-

rs876657397 in COL4A3;COL4A4 gene and ALPORT SYNDROME 2, AUTOSOMAL RECESSIVE PMID 23927549 2014 A founder mutation in COL4A3 causes autosomal recessive Alport syndrome in the Ashkenazi Jewish population.

PMID 28570636 2017 Alport syndrome cold cases: Missing mutations identified by exome sequencing and functional analysis.

PMID 22887978 2012 Genotype-phenotype correlations in 17 Chinese patients with autosomal recessive Alport syndrome.

PMID 24633401 2014 Natural history of genetically proven autosomal recessive Alport syndrome.