Variant: rs886037758 

    present in Gene: KIF26B;LOC105373265
    present in Chromosome: 1
    Position on Chromosome: 245688126
    Alleles of this Variant: ACCTCGCCCCCCAGCTCCGGGG/-

rs886037758 in KIF26B;LOC105373265 gene and Abnormal renal function PMID 26571382 2015 Association of PAX2 and Other Gene Mutations with the Clinical Manifestations of Renal Coloboma Syndrome.

rs886037758 in KIF26B;LOC105373265 gene and Coloboma of optic disc PMID 26571382 2015 Association of PAX2 and Other Gene Mutations with the Clinical Manifestations of Renal Coloboma Syndrome.