Variant: rs139707092 

    present in Gene: SPC25;NOSTRIN
    present in Chromosome: 2
    Position on Chromosome: 168850753
    Alleles of this Variant: TCTCTGGAAT/-;TCTCTGGAATTCTCTGGAAT

rs139707092 in SPC25;NOSTRIN gene and Blood basophil count (lab test) PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs139707092 in SPC25;NOSTRIN gene and Eosinophil count procedure PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs139707092 in SPC25;NOSTRIN gene and Granulocyte count PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs139707092 in SPC25;NOSTRIN gene and Neutrophil count (procedure) PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.

rs139707092 in SPC25;NOSTRIN gene and White Blood Cell Count procedure PMID 27863252 2016 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.