Condition: Hemoglobinopathies


rs281865475 in HBB gene and Hemoglobinopathies PMID 15481896 2004 A frameshift at codons 77/78 (-C): a novel beta-thalassemia mutation.

PMID 23383304 2013 Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China.

PMID 3403716 1988 New amber mutation in a beta-thalassemic gene with nonmeasurable levels of mutant messenger RNA in vivo.

PMID 19460936 2009 Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.

PMID 17008283 2006 Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PMID 25089872 2014 High resolution melting analysis: a rapid screening and typing tool for common β-thalassemia mutation in Chinese population.

PMID 21523319 2011 Molecular characteristics of three hemoglobin variants observed in a Chinese population: Hb Ube-1 [β98 (FG5) Val→Met], Hb Ube‑2 [α68 (E17) Asn→Asp] and Hb Ube‑4 [α116 (GH4) Glu→Ala].

PMID 20395516 2010 Comprehensive and efficient HBB mutation analysis for detection of beta-hemoglobinopathies in a pan-ethnic population.

PMID 6859036 1983 Percentages of abnormal hemoglobins in adults with a heterozygosity for an alpha-chain and/or a beta-chain variant.

PMID 27207683 2016 Report on Ten Years' Experience of Premarital Hemoglobinopathy Screening at a Center in Antalya, Southern Turkey.

PMID 20309827 2010 Abnormal hemoglobin phenotypes in carriers of mild anemia in Latin America.

PMID 5059650 1972 Oxygen affinity in hemoglobin Köln disease.

PMID 7860732 1995 Two missense mutations in the beta-globin gene can cause severe beta thalassemia. Hemoglobin Medicine Lake (beta 32[B14]leucine-->glutamine; 98 [FG5] valine-->methionine).

PMID 27821015 2016 Mutation in a Highly Conserved COOH-Terminal Residue of Krüppel-Like Factor 1 Associated with Elevated Hb F in a Compound Heterozygous β-Thalassemia Patient with a Nontransfusion-Dependent Thalassemia Phenotype.

PMID 7632967 1995 Reverse dot-blot detection of the African-American beta-thalassemia mutations.

PMID 21119755 2009 Profiling β-thalassaemia mutations in India at state and regional levels: implications for genetic education, screening and counselling programmes.

PMID 19437135 2010 Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques.

PMID 21423179 2011 Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PMID 24450243 2013 Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

PMID 1814858 1991 Detection of beta-thalassemia mutations by ASO hybridization of PCR amplified DNA with digoxigenin ddUTP labeled oligonucleotides.

PMID 1428943 1992 The -87 (C----A) beta(+)-thalassemia mutation in a black family.

PMID 11857746 2002 Reliability of DHPLC in mutational screening of beta-globin (HBB) alleles.

PMID 11857738 2002 HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PMID 20524821 2010 Phenotypic expression and origin of the rare beta-thalassemia splice site mutation HBB:c.315 + 1G>T.

PMID 2018842 1991 Thalassemia intermedia: moderate reduction of beta globin gene transcriptional activity by a novel mutation of the proximal CACCC promoter element.

PMID 3457470 1986 Fine structure genetic analysis of a beta-globin promoter.

PMID 12368169 2002 Rare and unexpected mutations among Iranian beta-thalassemia patients and prenatal samples discovered by reverse-hybridization and DNA sequencing.

PMID 6086605 1984 Base substitution at position -88 in a beta-thalassemic globin gene. Further evidence for the role of distal promoter element ACACCC.

PMID 10815781 2000 Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean.

PMID 22074124 2011 Molecular basis of β-thalassemia in the United Arab Emirates.

PMID 20437613 2010 Mutations of a country: a mutation review of single gene disorders in the United Arab Emirates (UAE).

PMID 28366028 2017 Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.

PMID 25408857 2014 Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia.

PMID 23321370 2013 The spectrum of β-thalassemia mutations in Gaza Strip, Palestine.

PMID 1384315 1992 Black beta-thalassemia homozygotes with specific sequence variations in the 5' hypersensitive site-2 of the locus control region have high levels of fetal hemoglobin.

PMID 1986379 1991 Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan.

PMID 26372288 2016 The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.

PMID 7158624 1982 Hemoglobin Osler: report of a new family with exercise studies before and after phlebotomy.

PMID 8701949 1996 Hemoglobin S/hemoglobin Osler: a case with 3 beta globin chains. DNA sequence (AAT) proves that Hb Osler is beta 145 Tyr-->Asn.

PMID 9101280 1997 Hb Osler [beta 145(HC2)Tyr-->Asp] results from posttranslational modification.

PMID 1117598 1975 Polycythemia produced by hemoglobin Osler (beta-145 (HC2) Tyr yields Asp).

PMID 21389146 2011 Mechanism of escape from nonsense-mediated mRNA decay of human beta-globin transcripts with nonsense mutations in the first exon.

PMID 16987801 2006 The prevalence and molecular basis of hemoglobinopathies in Cambodia.

PMID 19254853 2009 Regional heterogeneity of beta-thalassemia mutations in the multi ethnic Indian population.

PMID 1974422 1990 Molecular basis of HbE-beta-thalassemia and the origin of HbE in northeast Thailand: identification of one novel mutation using amplified DNA from buffy coat specimens.

PMID 12709369 2003 Rapid detection of beta-globin gene mutations and polymorphisms by temporal temperature gradient gel electrophoresis.

PMID 18294253 2008 Analysis of beta globin mutations in the Indian population: presence of rare and novel mutations and region-wise heterogeneity.

PMID 21797703 2011 Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.

PMID 3006832 1986 Use of oligonucleotide hybridization in the characterization of a beta zero-thalassemia gene (beta 37 TGG----TGA) in a Saudi Arabian family.

PMID 14734204 2004 Clinical and molecular aspects of haemoglobinopathies in Tunisia.

PMID 1520612 1992 High prevalence of the beta-thalassaemia nonsense 37 mutation in Catalonians from the Ebro delta.

PMID 15108284 2004 Real-time PCR for single-cell genotyping in sickle cell and thalassemia syndromes as a rapid, accurate, reliable, and widely applicable protocol for preimplantation genetic diagnosis.

PMID 18096416 2008 The molecular heterogeneity of beta-thalassemia in Greece.

PMID 18976160 2008 Molecular basis of beta-thalassemia in Morocco: possible origins of the molecular heterogeneity.

PMID 9140720 1997 A significant beta-thalassemia heterogeneity in the United Arab Emirates.

PMID 10081984 1999 The association of Hb Khartoum [beta124(H2)Pro-->Arg] with gamma+-thalassemia is responsible for hemolytic disease in the newborn of a Sudanese family.

PMID 26635043 2016 Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.

PMID 10490144 1999 Hb Khartoum [beta124(H2)Pro-->Arg] in a Vietnamese female.

PMID 19429541 2009 Impact of single nucleotide polymorphisms in HBB gene causing haemoglobinopathies: in silico analysis.

PMID 5782115 1969 Two new haemoglobin variants involving proline substitutions.

PMID 20113284 2010 Hemoglobinopathies in North Africa: a review.

PMID 9101288 1997 beta-thalassemia mutations in Japanese and Koreans.

PMID 21599435 2011 Molecular lesion frequency of hemoglobin gene disorders in Taiwan.

PMID 1686262 1991 A new beta-thalassemia mutation (initiation codon ATG----GTG) found in the Japanese population.

PMID 15315794 2005 Molecular spectrum of beta-thalassemia in the Mexican population.

PMID 9401495 1997 Levels of Hb A2 in heterozygotes and homozygotes for beta-thalassemia mutations: influence of mutations in the CACCC and ATAAA motifs of the beta-globin gene promoter.

PMID 20704537 2010 ThalassoChip, an array mutation and single nucleotide polymorphism detection tool for the diagnosis of β-thalassaemia.

PMID 10840054 2000 A downstream element in the human beta-globin promoter: evidence of extended sequence-specific transcription factor IID contacts.

PMID 11722417 2001 beta-Thalassaemia intermedia in a Turkish girl: homozygosity for G-->A substitution at +22 relative to the beta-globin cap site.

PMID 1536956 1992 Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene.

PMID 28603845 2017 Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PMID 1769663 1991 Molecular heterogeneity of beta-thalassemia in mestizo Mexicans.

PMID 8619407 1996 Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles.

PMID 18339318 2008 Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes.

PMID 2901867 1988 A novel beta-thalassemia frameshift mutation (codon 14/15), detectable by direct visualization of abnormal restriction fragment in amplified genomic DNA.

PMID 17949282 2007 Combination of Hb Knossos [Cod 27 (G-T)] and IVSII-745 (C-G) in a Turkish patient with beta-thalassemia major.

PMID 3955238 1986 Homozygous hemoglobin Knossos (alpha 2 beta 227(B9) Ala----Ser): a new variety of beta (+)-thalassemia intermedia associated with delta (0)-thalassemia.

PMID 9495372 1998 Molecular and population genetic analyses of beta-thalassemia in Turkey.

PMID 6733281 1984 Abnormal processing of beta Knossos RNA.

PMID 3942130 1986 Hemoglobin Knossos: a clinical, laboratory, and epidemiological study.

PMID 25332589 2014 Hb Knossos: HBB:c.82G>T Associated with HBB:c.315+1G>A Beta Zero Mutation Causes Thalassemia Intermedia.

PMID 15481885 2004 Contribution to the description of the beta-thalassemia spectrum in Tunisia and the origin of mutation diversity.

PMID 24828949 2014 Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.

PMID 3780671 1986 Beta zero thalassemia caused by a base substitution that creates an alternative splice acceptor site in an intron.

PMID 1850955 1991 A new frameshift beta zero-thalassemia mutation (codons 27-28 +C) found in a Chinese family.

PMID 15761692 2005 Parallel minisequencing followed by multiplex matrix-assisted laser desorption/ionization mass spectrometry assay for beta-thalassemia mutations.

PMID 8435318 1993 Molecular basis and haematological characterization of beta-thalassaemia major in Taiwan, with a mutation of IVS-1 3' end TAG-->GAG in a Chinese patient.

PMID 2014803 1991 The spectrum of beta-thalassemia mutations in Taiwan: identification of a novel frameshift mutation.

PMID 12955718 2003 Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC.

PMID 23590658 2013 Prenatal and newborn screening for hemoglobinopathies.

PMID 8199027 1994 The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci.

PMID 8081396 1994 A new frameshift mutation, insertion of ATCT, at codon 48 in the beta-globin gene causes beta-thalassemia in an Indian proband.

PMID 20132300 2010 Evaluation of the genetic basis of phenotypic heterogeneity in north Indian patients with thalassemia major.

PMID 22392582 2012 Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population.

PMID 22239493 2012 Experience with multiplex ARMS (MARMS)-PCR for the detection of common β-thalassemia mutations in India.

PMID 12779277 2003 Co-existence of the codon 16 (-C) (beta(o)) and codon 10 (C --> A) (beta+) mutations on the same beta-globin gene.

PMID 18954999 2009 Hydroxyurea in sickle cell disease--a study of clinico-pharmacological efficacy in the Indian haplotype.

PMID 12403498 2002 Identification of a compound beta-thalassemia homozygosity [codon 10 (GCC-->GCA) and codon 16 (-C)] in an Afghan family.

PMID 6714226 1984 Molecular characterization of seven beta-thalassemia mutations in Asian Indians.

PMID 8111050 1994 We describe a novel thalassemic hemoglobinopathy caused by a single nucleotide substitution (CTG-->CCG) at codon 114 resulting in a leucine to proline substitution and designate it beta Durham-NC [beta 114 Leu-->Pro].

PMID 8037185 1994 Beta-thalassemia alleles and unstable hemoglobin types among Russian pediatric patients.

PMID 12144056 2002 Beta-thalassemia in the Korean population.

PMID 8980256 1997 Genetic analysis of beta-thalassemia intermedia in Israel: diversity of mechanisms and unpredictability of phenotype.

PMID 19486366 2010 Clinical and haematological features in a compound heterozygote (HBB:c.92 + 5G > C/HBB:c.93-2A > C) case of thalassaemia major.

PMID 27828729 2017 Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.

PMID 12752111 2003 The molecular basis for the thalassaemias in Sri Lanka.