Gene: HBB

Alternate names for this Gene: CD113t-C|ECYT6|beta-globin

Gene Summary: The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'.

Gene is located in Chromosome: 11

Location in Chromosome : 11p15.4

Description of this Gene: hemoglobin subunit beta

Type of Gene: protein-coding

rs334 in HBB gene and Anemia, Sickle Cell PMID 25023085 2014 Prevalence of the β(S) gene among scheduled castes, scheduled tribes and other backward class groups in Central India.

PMID 1195378 1975 Crystal structure of sickle-cell deoxyhemoglobin at 5 A resolution.

PMID 24100324 2013 Structure of fully liganded Hb ζ2β2s trapped in a tense conformation.

PMID 13464827 1957 Gene mutations in human haemoglobin: the chemical difference between normal and sickle cell haemoglobin.

PMID 26275168 2016 The Prevalence of Sickle Cell Disease and Its Implication for Newborn Screening in Germany (Hamburg Metropolitan Area).

PMID 25023084 2014 Prevalence of sickle cell disease in a pediatric population suffering from severe infections: a Congolese experience.

PMID 16001361 2005 How malaria has affected the human genome and what human genetics can teach us about malaria.

rs334 in HBB gene and Blood basophil count (lab test) PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Corpuscular Hemoglobin Concentration Mean PMID 31217584 2019 Genetic analyses of diverse populations improves discovery for complex traits.

PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

PMID 28453575 2017 Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos.

rs334 in HBB gene and Diabetes PMID 31451708 2019 Mapping eGFR loci to the renal transcriptome and phenome in the VA Million Veteran Program.

rs334 in HBB gene and Diabetes Mellitus PMID 31451708 2019 Mapping eGFR loci to the renal transcriptome and phenome in the VA Million Veteran Program.

rs334 in HBB gene and Eosinophil count procedure PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs1003586 in HBB gene and Fetal hemoglobin determination PMID 18245381 2008 Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia.

rs334 in HBB gene and Glomerular Filtration Rate PMID 31451708 2019 Mapping eGFR loci to the renal transcriptome and phenome in the VA Million Veteran Program.

rs334 in HBB gene and Hematocrit procedure PMID 28453575 2017 Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos.

rs33950507 in HBB gene and Hemoglobin E disease PMID 21732929 2011 Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PMID 26554862 2016 Clinical, Hematological and Molecular Analysis of Homozygous Hb E (HBB: c.79G > A) in the Indian Population.

PMID 25370867 2014 Molecular characterization of a β-thalassemia intermedia patient presenting inferior vena cava thrombosis: interaction of the β-globin erythroid Krüppel-like factor binding site mutation with Hb E and α(+)-thalassemia.

PMID 22260787 2012 A transgenic mouse model expressing exclusively human hemoglobin E: indications of a mild oxidative stress.

rs281865475 in HBB gene and Hemoglobinopathies PMID 15481896 2004 A frameshift at codons 77/78 (-C): a novel beta-thalassemia mutation.

PMID 23383304 2013 Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China.

PMID 3403716 1988 New amber mutation in a beta-thalassemic gene with nonmeasurable levels of mutant messenger RNA in vivo.

PMID 19460936 2009 Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.

PMID 17008283 2006 Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PMID 25089872 2014 High resolution melting analysis: a rapid screening and typing tool for common β-thalassemia mutation in Chinese population.

PMID 21523319 2011 Molecular characteristics of three hemoglobin variants observed in a Chinese population: Hb Ube-1 [β98 (FG5) Val→Met], Hb Ube‑2 [α68 (E17) Asn→Asp] and Hb Ube‑4 [α116 (GH4) Glu→Ala].

PMID 20395516 2010 Comprehensive and efficient HBB mutation analysis for detection of beta-hemoglobinopathies in a pan-ethnic population.

PMID 6859036 1983 Percentages of abnormal hemoglobins in adults with a heterozygosity for an alpha-chain and/or a beta-chain variant.

PMID 27207683 2016 Report on Ten Years' Experience of Premarital Hemoglobinopathy Screening at a Center in Antalya, Southern Turkey.

PMID 20309827 2010 Abnormal hemoglobin phenotypes in carriers of mild anemia in Latin America.

PMID 5059650 1972 Oxygen affinity in hemoglobin Köln disease.

PMID 7860732 1995 Two missense mutations in the beta-globin gene can cause severe beta thalassemia. Hemoglobin Medicine Lake (beta 32[B14]leucine-->glutamine; 98 [FG5] valine-->methionine).

PMID 27821015 2016 Mutation in a Highly Conserved COOH-Terminal Residue of Krüppel-Like Factor 1 Associated with Elevated Hb F in a Compound Heterozygous β-Thalassemia Patient with a Nontransfusion-Dependent Thalassemia Phenotype.

PMID 7632967 1995 Reverse dot-blot detection of the African-American beta-thalassemia mutations.

PMID 21119755 2009 Profiling β-thalassaemia mutations in India at state and regional levels: implications for genetic education, screening and counselling programmes.

PMID 19437135 2010 Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques.

PMID 21423179 2011 Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PMID 24450243 2013 Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

PMID 1814858 1991 Detection of beta-thalassemia mutations by ASO hybridization of PCR amplified DNA with digoxigenin ddUTP labeled oligonucleotides.

PMID 1428943 1992 The -87 (C----A) beta(+)-thalassemia mutation in a black family.

PMID 11857746 2002 Reliability of DHPLC in mutational screening of beta-globin (HBB) alleles.

PMID 11857738 2002 HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PMID 20524821 2010 Phenotypic expression and origin of the rare beta-thalassemia splice site mutation HBB:c.315 + 1G>T.

PMID 2018842 1991 Thalassemia intermedia: moderate reduction of beta globin gene transcriptional activity by a novel mutation of the proximal CACCC promoter element.

PMID 3457470 1986 Fine structure genetic analysis of a beta-globin promoter.

PMID 12368169 2002 Rare and unexpected mutations among Iranian beta-thalassemia patients and prenatal samples discovered by reverse-hybridization and DNA sequencing.

PMID 6086605 1984 Base substitution at position -88 in a beta-thalassemic globin gene. Further evidence for the role of distal promoter element ACACCC.

PMID 10815781 2000 Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean.

PMID 22074124 2011 Molecular basis of β-thalassemia in the United Arab Emirates.

PMID 20437613 2010 Mutations of a country: a mutation review of single gene disorders in the United Arab Emirates (UAE).

PMID 28366028 2017 Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.

PMID 25408857 2014 Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia.

PMID 23321370 2013 The spectrum of β-thalassemia mutations in Gaza Strip, Palestine.

PMID 1384315 1992 Black beta-thalassemia homozygotes with specific sequence variations in the 5' hypersensitive site-2 of the locus control region have high levels of fetal hemoglobin.

PMID 1986379 1991 Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan.

PMID 26372288 2016 The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.

PMID 7158624 1982 Hemoglobin Osler: report of a new family with exercise studies before and after phlebotomy.

PMID 8701949 1996 Hemoglobin S/hemoglobin Osler: a case with 3 beta globin chains. DNA sequence (AAT) proves that Hb Osler is beta 145 Tyr-->Asn.

PMID 9101280 1997 Hb Osler [beta 145(HC2)Tyr-->Asp] results from posttranslational modification.

PMID 1117598 1975 Polycythemia produced by hemoglobin Osler (beta-145 (HC2) Tyr yields Asp).

PMID 21389146 2011 Mechanism of escape from nonsense-mediated mRNA decay of human beta-globin transcripts with nonsense mutations in the first exon.

PMID 16987801 2006 The prevalence and molecular basis of hemoglobinopathies in Cambodia.

PMID 19254853 2009 Regional heterogeneity of beta-thalassemia mutations in the multi ethnic Indian population.

PMID 1974422 1990 Molecular basis of HbE-beta-thalassemia and the origin of HbE in northeast Thailand: identification of one novel mutation using amplified DNA from buffy coat specimens.

PMID 12709369 2003 Rapid detection of beta-globin gene mutations and polymorphisms by temporal temperature gradient gel electrophoresis.

PMID 18294253 2008 Analysis of beta globin mutations in the Indian population: presence of rare and novel mutations and region-wise heterogeneity.

PMID 21797703 2011 Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.

PMID 3006832 1986 Use of oligonucleotide hybridization in the characterization of a beta zero-thalassemia gene (beta 37 TGG----TGA) in a Saudi Arabian family.

PMID 14734204 2004 Clinical and molecular aspects of haemoglobinopathies in Tunisia.

PMID 1520612 1992 High prevalence of the beta-thalassaemia nonsense 37 mutation in Catalonians from the Ebro delta.

PMID 15108284 2004 Real-time PCR for single-cell genotyping in sickle cell and thalassemia syndromes as a rapid, accurate, reliable, and widely applicable protocol for preimplantation genetic diagnosis.

PMID 18096416 2008 The molecular heterogeneity of beta-thalassemia in Greece.

PMID 18976160 2008 Molecular basis of beta-thalassemia in Morocco: possible origins of the molecular heterogeneity.

PMID 9140720 1997 A significant beta-thalassemia heterogeneity in the United Arab Emirates.

PMID 10081984 1999 The association of Hb Khartoum [beta124(H2)Pro-->Arg] with gamma+-thalassemia is responsible for hemolytic disease in the newborn of a Sudanese family.

PMID 26635043 2016 Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.

PMID 10490144 1999 Hb Khartoum [beta124(H2)Pro-->Arg] in a Vietnamese female.

PMID 19429541 2009 Impact of single nucleotide polymorphisms in HBB gene causing haemoglobinopathies: in silico analysis.

PMID 5782115 1969 Two new haemoglobin variants involving proline substitutions.

PMID 20113284 2010 Hemoglobinopathies in North Africa: a review.

PMID 9101288 1997 beta-thalassemia mutations in Japanese and Koreans.

PMID 21599435 2011 Molecular lesion frequency of hemoglobin gene disorders in Taiwan.

PMID 1686262 1991 A new beta-thalassemia mutation (initiation codon ATG----GTG) found in the Japanese population.

PMID 15315794 2005 Molecular spectrum of beta-thalassemia in the Mexican population.

PMID 9401495 1997 Levels of Hb A2 in heterozygotes and homozygotes for beta-thalassemia mutations: influence of mutations in the CACCC and ATAAA motifs of the beta-globin gene promoter.

PMID 20704537 2010 ThalassoChip, an array mutation and single nucleotide polymorphism detection tool for the diagnosis of β-thalassaemia.

PMID 10840054 2000 A downstream element in the human beta-globin promoter: evidence of extended sequence-specific transcription factor IID contacts.

PMID 11722417 2001 beta-Thalassaemia intermedia in a Turkish girl: homozygosity for G-->A substitution at +22 relative to the beta-globin cap site.

PMID 1536956 1992 Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene.

PMID 28603845 2017 Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PMID 1769663 1991 Molecular heterogeneity of beta-thalassemia in mestizo Mexicans.

PMID 8619407 1996 Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles.

PMID 18339318 2008 Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes.

PMID 2901867 1988 A novel beta-thalassemia frameshift mutation (codon 14/15), detectable by direct visualization of abnormal restriction fragment in amplified genomic DNA.

PMID 17949282 2007 Combination of Hb Knossos [Cod 27 (G-T)] and IVSII-745 (C-G) in a Turkish patient with beta-thalassemia major.

PMID 3955238 1986 Homozygous hemoglobin Knossos (alpha 2 beta 227(B9) Ala----Ser): a new variety of beta (+)-thalassemia intermedia associated with delta (0)-thalassemia.

PMID 9495372 1998 Molecular and population genetic analyses of beta-thalassemia in Turkey.

PMID 6733281 1984 Abnormal processing of beta Knossos RNA.

PMID 3942130 1986 Hemoglobin Knossos: a clinical, laboratory, and epidemiological study.

PMID 25332589 2014 Hb Knossos: HBB:c.82G>T Associated with HBB:c.315+1G>A Beta Zero Mutation Causes Thalassemia Intermedia.

PMID 15481885 2004 Contribution to the description of the beta-thalassemia spectrum in Tunisia and the origin of mutation diversity.

PMID 24828949 2014 Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.

PMID 3780671 1986 Beta zero thalassemia caused by a base substitution that creates an alternative splice acceptor site in an intron.

PMID 1850955 1991 A new frameshift beta zero-thalassemia mutation (codons 27-28 +C) found in a Chinese family.

PMID 15761692 2005 Parallel minisequencing followed by multiplex matrix-assisted laser desorption/ionization mass spectrometry assay for beta-thalassemia mutations.

PMID 8435318 1993 Molecular basis and haematological characterization of beta-thalassaemia major in Taiwan, with a mutation of IVS-1 3' end TAG-->GAG in a Chinese patient.

PMID 2014803 1991 The spectrum of beta-thalassemia mutations in Taiwan: identification of a novel frameshift mutation.

PMID 12955718 2003 Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC.

PMID 23590658 2013 Prenatal and newborn screening for hemoglobinopathies.

PMID 8199027 1994 The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci.

PMID 8081396 1994 A new frameshift mutation, insertion of ATCT, at codon 48 in the beta-globin gene causes beta-thalassemia in an Indian proband.

PMID 20132300 2010 Evaluation of the genetic basis of phenotypic heterogeneity in north Indian patients with thalassemia major.

PMID 22392582 2012 Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population.

PMID 22239493 2012 Experience with multiplex ARMS (MARMS)-PCR for the detection of common β-thalassemia mutations in India.

PMID 12779277 2003 Co-existence of the codon 16 (-C) (beta(o)) and codon 10 (C --> A) (beta+) mutations on the same beta-globin gene.

PMID 18954999 2009 Hydroxyurea in sickle cell disease--a study of clinico-pharmacological efficacy in the Indian haplotype.

PMID 12403498 2002 Identification of a compound beta-thalassemia homozygosity [codon 10 (GCC-->GCA) and codon 16 (-C)] in an Afghan family.

PMID 6714226 1984 Molecular characterization of seven beta-thalassemia mutations in Asian Indians.

PMID 8111050 1994 We describe a novel thalassemic hemoglobinopathy caused by a single nucleotide substitution (CTG-->CCG) at codon 114 resulting in a leucine to proline substitution and designate it beta Durham-NC [beta 114 Leu-->Pro].

PMID 8037185 1994 Beta-thalassemia alleles and unstable hemoglobin types among Russian pediatric patients.

PMID 12144056 2002 Beta-thalassemia in the Korean population.

PMID 8980256 1997 Genetic analysis of beta-thalassemia intermedia in Israel: diversity of mechanisms and unpredictability of phenotype.

PMID 19486366 2010 Clinical and haematological features in a compound heterozygote (HBB:c.92 + 5G > C/HBB:c.93-2A > C) case of thalassaemia major.

PMID 27828729 2017 Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.

PMID 12752111 2003 The molecular basis for the thalassaemias in Sri Lanka.

rs281864519 in HBB gene and Malaria PMID 19465909 2009 Genome-wide and fine-resolution association analysis of malaria in West Africa.

PMID 22895189 2012 Genome-wide association study indicates two novel resistance loci for severe malaria.

PMID 29381699 2018 Novel genetic polymorphisms associated with severe malaria and under selective pressure in North-eastern Tanzania.

rs334 in HBB gene and Mean Corpuscular Volume (result) PMID 28453575 2017 Genome-wide association study of red blood cell traits in Hispanics/Latinos: The Hispanic Community Health Study/Study of Latinos.

PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Monocyte count procedure PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Monocyte count result PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Muscle hypotonia PMID 10602954 1999 Imaging features of thalassemia.

PMID 19958185 2009 Multiplex ligation-dependent probe amplification identification of 17 different beta-globin gene deletions (including four novel mutations) in the UK population.

PMID 11545326 2001 Inherited haemoglobin disorders: an increasing global health problem.

PMID 21131035 2010 Sickle-cell disease.

PMID 49057 1975 Human globin gene analysis for a patient with beta-o/delta beta-thalassemia.

PMID 20492708 2010 Beta-thalassemia.

PMID 23729725 2013 Non-transfusion-dependent thalassemias.

rs334 in HBB gene and Neutrophil count (procedure) PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Platelet Count measurement PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Platelet mean volume determination (procedure) PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and RDW - Red blood cell distribution width result PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

PMID 31675503 2019 Uganda Genome Resource Enables Insights into Population History and Genomic Discovery in Africa.

rs334 in HBB gene and Red Blood Cell Count measurement PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs334 in HBB gene and Red cell distribution width determination PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

PMID 31675503 2019 Uganda Genome Resource Enables Insights into Population History and Genomic Discovery in Africa.

rs33946267 in HBB gene and Sickle cell-Hemoglobin O Arab disease PMID 9834244 1998 HbS-oman heterozygote: a new dominant sickle syndrome.

PMID 3859465 1985 The interaction of hemoglobin O Arab with Hb S and beta+ thalassemia among Israeli Arabs.

PMID 11179419 2001 Characterization of syntenin, a syndecan-binding PDZ protein, as a component of cell adhesion sites and microfilaments.

PMID 22975760 2013 An empirical estimate of carrier frequencies for 400+ causal Mendelian variants: results from an ethnically diverse clinical sample of 23,453 individuals.

PMID 5481775 1970 Hemoglobin O arab in four negro families and its interaction with hemoglobin S and hemoglobin C.

PMID 24880717 2014 Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology.

PMID 1732017 1992 Hemoglobin variants and activity of the (K+Cl-) cotransport system in human erythrocytes.

PMID 1112610 1975 Twelve families with Hb O Arab in the Burgas district of Bulgaria. Observations on sixteen examples of Hb O Arab-beta (0) thalassaemia.

rs334 in HBB gene and Uric acid measurement (procedure) PMID 31578528 2019 Target genes, variants, tissues and transcriptional pathways influencing human serum urate levels.

rs334 in HBB gene and White Blood Cell Count procedure PMID 31080455 2019 Complimentary Methods for Multivariate Genome-Wide Association Study Identify New Susceptibility Genes for Blood Cell Traits.

rs11549407 in HBB gene and beta Thalassemia PMID 22975760 2013 An empirical estimate of carrier frequencies for 400+ causal Mendelian variants: results from an ethnically diverse clinical sample of 23,453 individuals.

PMID 25087612 2014 Pathogenic variants for Mendelian and complex traits in exomes of 6,517 European and African Americans: implications for the return of incidental results.

PMID 25572186 2015 Identification of a novel mutation in the β-globin gene 3' untranslated region (HBB: c.*+118A > G) in Spain.

PMID 23321370 2013 The spectrum of β-thalassemia mutations in Gaza Strip, Palestine.

PMID 21228398 2011 Carrier testing for severe childhood recessive diseases by next-generation sequencing.

PMID 1734721 1992 Molecular characterization of beta-thalassemia in the Sardinian population.

PMID 21417574 2011 A second observation of the rare frameshift mutation in the β-globin gene: codon 46 (+A) (Hbb:c.138_139insA).

PMID 22271886 2012 Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion.

PMID 21389146 2011 Mechanism of escape from nonsense-mediated mRNA decay of human beta-globin transcripts with nonsense mutations in the first exon.

PMID 6457059 1981 beta zero thalassemia in Sardinia is caused by a nonsense mutation.

PMID 25525381 2014 Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study.

PMID 7558879 1995 The beta- and delta-thalassemia repository (eighth edition).

PMID 23525874 2013 Problems in determining thalassemia carrier status in a program for prevention and control of severe thalassemia syndromes: a lesson from Thailand.

PMID 19460936 2009 Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.

PMID 2070092 1991 Eight-base deletion in exon 3 of the beta-globin gene produced a novel variant (beta khon kaen) with an inclusion body beta-thalassemia trait.

PMID 23637309 2013 The molecular basis of β-thalassemia.

PMID 21797702 2011 Molecular basis of β-thalassemia in the western province of Saudi Arabia: identification of rare β-thalassemia mutations.

PMID 20113289 2010 Molecular epidemiology investigation of beta-thalassemia in Zhongshan City, Guangdong Province, People's Republic of China.

PMID 11186264 2000 Two novel beta-thalassemia alleles in the Chinese: the IVS-II-2 (-T) and nucleotide +8 (C-->T) beta-globin gene mutations.

PMID 21704277 2011 A melting curve analysis--based PCR assay for one-step genotyping of β-thalassemia mutations a multicenter validation.

PMID 24719849 2014 β -thalassemia intermedia in Northern Iraq: a single center experience.

PMID 24052702 2011 Molecular Genetic Characterization of β-Thalassemia and Sickle Cell Syndrome in the Albanian Population.

PMID 1740317 1992 Molecular characterization of beta-thalassemia in Czechoslovakia.

PMID 1517107 1992 A mutation of CDS 82/83 (-G) observed in a Yugoslavian family with a heterozygosity for beta-thalassemia.

PMID 20437613 2010 Mutations of a country: a mutation review of single gene disorders in the United Arab Emirates (UAE).

PMID 25825561 2015 Novel Βeta (β)-Thalassemia Mutation in Turkish Children.

PMID 19437135 2010 Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques.

PMID 2525253 1989 A novel frameshift mutation causing beta-thalassaemia in Azerbaijan.

PMID 22356097 2012 Prevalence and molecular analysis of β-thalassemia in Adiyaman, Turkey.

PMID 9140720 1997 A significant beta-thalassemia heterogeneity in the United Arab Emirates.

PMID 24052746 2012 Molecular Diagnostics of β-Thalassemia.

PMID 9401495 1997 Levels of Hb A2 in heterozygotes and homozygotes for beta-thalassemia mutations: influence of mutations in the CACCC and ATAAA motifs of the beta-globin gene promoter.

PMID 20975770 2010 Current Genetic Epidemiology of β-Thalassemias and Structural Hemoglobin Variants in the Lazio Region (Central Italy) Following Recent Migration Movements.

PMID 24828949 2014 Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.

PMID 25016698 2014 Frequency of beta-thalassemia or beta-hemoglobinopathy carriers simultaneously affected with alpha-thalassemia in Iran.

PMID 26076396 2015 Clinical and Molecular Characteristics of Non-Transfusion-Dependent Thalassemia in Kuwait.

PMID 6190800 1983 Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia.

PMID 12709369 2003 Rapid detection of beta-globin gene mutations and polymorphisms by temporal temperature gradient gel electrophoresis.

PMID 26291967 2015 Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

PMID 2736244 1989 Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major.

PMID 26076395 2015 Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.

PMID 22983591 2013 Mosaic segmental uniparental isodisomy and progressive clonal selection: a common mechanism of late onset β-thalassemia major.

PMID 20704537 2010 ThalassoChip, an array mutation and single nucleotide polymorphism detection tool for the diagnosis of β-thalassaemia.

PMID 3408672 1988 The spectrum of beta-thalassaemia mutations in Sicily.

PMID 7759073 1995 The great heterogeneity of thalassemia molecular defects in Sicily.

PMID 20954261 2011 Bone marrow necrosis and sickle cell crisis associated with double heterozygosity for HbS and HbOARAB.

PMID 19061217 2009 Newborn screening for hemoglobinopathies in California.

PMID 2888754 1987 Effect of amino acid at the beta 6 position on surface hydrophobicity, stability, solubility, and the kinetics of polymerization of hemoglobin. Comparisons among Hb A (Glu beta 6), Hb C (Lys beta 6), Hb Machida (Gln beta 6), and Hb S (Val beta 6).

PMID 6583683 1984 Origin of the beta S-globin gene in blacks: the contribution of recurrent mutation or gene conversion or both.

PMID 1376298 1992 A novel sickle cell mutation of yet another origin in Africa: the Cameroon type.

PMID 2582106 1985 Clinical presentation of homozygous sickle cell disease.

PMID 22028795 2011 In silico analysis of single nucleotide polymorphism (SNPs) in human β-globin gene.

PMID 22625666 2012 Hb S [β6(A3)Glu→Val, GAG>GTG] and β-globin gene cluster haplotype distribution in Mauritania.

PMID 22010933 2011 A novel sickling hemoglobinopathy.

PMID 25155404 2014 The spectrum of β-thalassemia mutations in Hatay, Turkey: reporting three new mutations.

PMID 2920213 1989 Beta-thalassemia due to two novel nucleotide substitutions in consensus acceptor splice sequences of the beta-globin gene.

PMID 17365006 2007 Study of beta-Thalassemia mutations using the polymerase chain reaction-amplification refractory mutation system and direct DNA sequencing techniques in a group of Egyptian Thalassemia patients.

PMID 25480500 2015 A genetic score for the prediction of beta-thalassemia severity.

PMID 8477263 1993 Molecular characterization of beta-thalassemia in Egyptians.

PMID 2458145 1988 Clinical and genetic heterogeneity in black patients with homozygous beta-thalassemia from the southeastern United States.

PMID 21250876 2011 Hb S-β-thalassemia: molecular, hematological and clinical comparisons.

PMID 2987809 1985 Beta-thalassemia resulting from a single nucleotide substitution in an acceptor splice site.

PMID 1897518 1991 Molecular characterization of Hb S(C) beta-thalassemia in American blacks.

PMID 2123063 1990 Compound heterozygosity for a mild beta (+) and a rare beta(0)-thalassemia allele.

PMID 9342003 1997 Combinations of beta chain abnormal hemoglobins with each other or with beta-thalassemia determinants with known mutations: influence on phenotype.

PMID 22981786 2013 Characterization of three new deletions in the β-globin gene cluster during a screening survey in two French urban areas.

PMID 6583702 1984 "beta-Thalassemia in American Blacks: novel mutations in the ""TATA"" box and an acceptor splice site."

PMID 7632967 1995 Reverse dot-blot detection of the African-American beta-thalassemia mutations.

PMID 22563936 2012 Molecular spectrum of β-thalassemia mutations in the admixed Venezuelan population, and their linkage to β-globin gene haplotypes.

PMID 8118466 1994 Reverse dot blot probes for the screening of beta-thalassemia mutations in Asians and American blacks.

PMID 18294253 2008 Analysis of beta globin mutations in the Indian population: presence of rare and novel mutations and region-wise heterogeneity.

PMID 10815781 2000 Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean.

PMID 14576320 2003 Intrinsic differences between authentic and cryptic 5' splice sites.

PMID 16291734 2005 Changes in the epidemiology of thalassemia in North America: a new minority disease.

PMID 19000664 2009 Inherited hemoglobin disorders in Andhra Pradesh, India: a population study.

PMID 15278762 2004 Molecular genetic analyses of beta-thalassemia in South India reveals rare mutations in the beta-globin gene.

PMID 20132300 2010 Evaluation of the genetic basis of phenotypic heterogeneity in north Indian patients with thalassemia major.

PMID 15315794 2005 Molecular spectrum of beta-thalassemia in the Mexican population.

PMID 1917531 1991 Beta-thalassemia, HB S-beta-thalassemia and sickle cell anemia among Tunisians.

PMID 2703241 1989 Mutation analysis of beta-thalassemia genes in a German family reveals a rare transversion in the first intron.

PMID 3671081 1987 Expression of a beta thalassemia gene with abnormal splicing.

PMID 2200760 1990 Beta-thalassemia in Turkey.

PMID 6714226 1984 Molecular characterization of seven beta-thalassemia mutations in Asian Indians.

PMID 6188062 1983 Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes.

PMID 3021139 1986 Beta thalassemia due to a novel mutation in IVS 1 sequence donor site consensus sequence creating a restriction site.

PMID 23590658 2013 Prenatal and newborn screening for hemoglobinopathies.

PMID 2439149 1987 A new mutation in IVS-1 of the human beta globin gene causing beta thalassemia due to abnormal splicing.

PMID 17008283 2006 Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PMID 9028819 1997 Compound heterozygosity for Hb Lepore-Boston and Hb Neapolis (Dhonburi) [beta 126(H4)Val-->Gly] in a patient from Naples, Italy.

PMID 1463768 1992 Heterozygosity for the IVS-I-5 (G-->C) mutation with a G-->A change at codon 18 (Val-->Met; Hb Baden) in cis and a T-->G mutation at codon 126 (Val-->Gly; Hb Dhonburi) in trans resulting in a thalassemia intermedia.

PMID 7693620 1993 Hb Hradec Kralove (Hb HK) or alpha 2 beta 2 115(G17)Ala-->Asp, a severely unstable hemoglobin variant resulting in a dominant beta-thalassemia trait in a Czech family.

PMID 17994378 2007 Multicenter study of the molecular basis of thalassemia intermedia in different ethnic populations.

PMID 1954392 1991 Hemoglobin Neapolis, beta 126(H4)Val----Gly: a novel beta-chain variant associated with a mild beta-thalassemia phenotype and displaying anomalous stability features.

PMID 6166632 1981 Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

PMID 12149194 2002 Hemoglobin E: a balanced polymorphism protective against high parasitemias and thus severe P falciparum malaria.

PMID 17606453 2007 Neapolis (CD 126 beta+ GGT->GGG): a result of a screening in Campania, a region in Southern Italy.

PMID 2399911 1990 Hemoglobin Dhonburi alpha 2 beta 2 126 (H4) Val----Gly: a new unstable beta variant producing a beta-thalassemia intermedia phenotype in association with beta zero-thalassemia.

PMID 7530406 1995 Genetic heterogeneity of beta-thalassemia in southeast Sicily.

PMID 15481886 2004 The 'hot-spot' of Hb E [beta26(B8)Glu-->Lys] in Southeast Asia: beta-globin anomalies in the Lao Theung population of southern Laos.

PMID 12144064 2002 Double heterozygosity for Hb Pyrgos [beta83(EF7)Gly-->Asp] and Hb E [beta26(B8)Glu-->Lys] found in association with alpha-thalassemia.

PMID 23297836 2013 The clinical and laboratory spectrum of Hb C [β6(A3)Glu→Lys, GAG>AAG] disease.

PMID 7137165 1982 Clinical, hematological, and biochemical features of Hb SC disease.

PMID 11001883 2000 Hemoglobin C associated with protection from severe malaria in the Dogon of Mali, a West African population with a low prevalence of hemoglobin S.

PMID 8294201 1993 Identification of Hb C [beta 6(A3)Glu-->Lys] in a Thai male.

PMID 16103715 2005 Mutations associated with beta-thalassemia intermedia in Kuwait.

PMID 18976160 2008 Molecular basis of beta-thalassemia in Morocco: possible origins of the molecular heterogeneity.

PMID 24616209 2014 The mechanism by which TATA-box polymorphisms associated with human hereditary diseases influence interactions with the TATA-binding protein.

PMID 6308558 1983 ATA box transcription mutation in beta-thalassemia.

PMID 9160698 1997 A novel beta+-thalassemia mutation (codon 10 GCC --> GCA) and a rare transcriptional mutation (-28A --> G) in Indians.

PMID 2987224 1985 Functional analysis of a beta-globin gene containing a TATA box mutation from a Kurdish Jew with beta thalassemia.

PMID 7076659 1982 beta-Thalassemia in a Kurdish Jew. Single base changes in the T-A-T-A box.

PMID 14734204 2004 Clinical and molecular aspects of haemoglobinopathies in Tunisia.

PMID 8619407 1996 Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles.

PMID 19960060 2009 beta-Thalassaemia Major in a Spanish Patient due to a Compound Heterozygosity for CD39 C --> T/-28 A --> C.

PMID 8435318 1993 Molecular basis and haematological characterization of beta-thalassaemia major in Taiwan, with a mutation of IVS-1 3' end TAG-->GAG in a Chinese patient.

PMID 2917193 1989 Thalassemia intermedia resulting from a mild beta-thalassemia mutation.

PMID 2375912 1990 The homozygous state for the -87 C----G beta + thalassaemia.

PMID 2446680 1988 Mild and severe beta-thalassemia among homozygotes from Turkey: identification of the types by hybridization of amplified DNA with synthetic probes.

PMID 12779270 2003 Analysis of beta-thalassemia mutations in northern Thailand using an automated fluorescence DNA sequencing technique.

PMID 1428943 1992 The -87 (C----A) beta(+)-thalassemia mutation in a black family.

PMID 2837728 1988 An erythroid specific nuclear factor binding to the proximal CACCC box of the beta-globin gene promoter.

PMID 16114187 2005 A mutation of the beta-globin gene initiation codon, ATG-->AAG, found in a French Caucasian man.

PMID 24086942 2013 Hereditary hemolytic anemia in Korea from 2007 to 2011: A study by the Korean Hereditary Hemolytic Anemia Working Party of the Korean Society of Hematology.

PMID 28643346 2017 Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

PMID 1517111 1992 A beta-thalassemia mutation found in Korea.

PMID 19429541 2009 Impact of single nucleotide polymorphisms in HBB gene causing haemoglobinopathies: in silico analysis.

PMID 9629504 1998 Historical note: the beta-thalassemia allele in the noble Russian family Lermontov is identified as the ATG-->ACG change in the initiation codon.

PMID 18694524 2008 Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations.

PMID 8094943 1993 De novo initiation codon mutation (ATG-->ACG) of the beta-globin gene causing beta-thalassemia in a Swiss family.

PMID 9371531 1997 De novo mutation of the beta-globin gene initiation codon (ATG-->AAG) in a Northern European boy.

PMID 9101288 1997 beta-thalassemia mutations in Japanese and Koreans.

PMID 12368169 2002 Rare and unexpected mutations among Iranian beta-thalassemia patients and prenatal samples discovered by reverse-hybridization and DNA sequencing.

PMID 2306523 1990 A new single nucleotide change at the initiation codon (ATG----AGG) identified in amplified genomic DNA of a Chinese beta-thalassemic patient.

PMID 14715623 2004 Evaluation of alpha hemoglobin stabilizing protein (AHSP) as a genetic modifier in patients with beta thalassemia.

PMID 2272840 1990 An initiation codon mutation as a cause of a beta-thalassemia.

PMID 12955718 2003 Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC.

PMID 22335963 2012 Molecular study and genotype/phenotype correlation of β Thalassemia in Malaysia.

PMID 19631632 2009 Rapid identification of HBB gene mutations by high-resolution melting analysis.

PMID 10706767 2000 A rare mutation [IVS-I-130 (G-A)] in a Turkish beta-thalassemia major patient.

PMID 2283297 1990 A new beta-thalassemia mutation produced by a single nucleotide substitution in the conserved dinucleotide sequence of the IVS-I consensus acceptor site (AG----AA).

PMID 21333566 2011 The association between intragenic SNP haplotypes and mutations of the beta globin gene in a Turkish population.

PMID 1986379 1991 Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan.

PMID 18654889 2008 An unusually frequent beta-thalassemia mutation in an Iranian Province.

PMID 22074124 2011 Molecular basis of β-thalassemia in the United Arab Emirates.

PMID 25408857 2014 Spectrum of Beta Globin Gene Mutations in Egyptian Children with β-Thalassemia.

PMID 26948378 2017 The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran.

PMID 21232998 2011 Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

PMID 22180324 2012 Genotype-phenotype relationship of patients with β-thalassemia taking hydroxyurea: a 13-year experience in Iran.

PMID 24265529 2013 Clinical characteristics of pediatric thalassemia in Korea: a single institute experience.

PMID 9163586 1997 Beta-thalassaemia in the immigrant and non-immigrant German populations.

PMID 6086605 1984 Base substitution at position -88 in a beta-thalassemic globin gene. Further evidence for the role of distal promoter element ACACCC.

PMID 27756326 2016 Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

PMID 1483699 1992 Molecular characterization of beta-thalassemia in Azerbaijan.

PMID 15654898 2005 Serum ferritin level as a predictor of impaired growth and puberty in thalassemia major patients.

PMID 25332589 2014 Hb Knossos: HBB:c.82G>T Associated with HBB:c.315+1G>A Beta Zero Mutation Causes Thalassemia Intermedia.

PMID 7151176 1982 A single-base change at a splice site in a beta 0-thalassemic gene causes abnormal RNA splicing.

PMID 25525159 2015 RNA splicing. The human splicing code reveals new insights into the genetic determinants of disease.

PMID 7558878 1995 A newly discovered beta O-thalassemia (IVS-II-850, G-->A) mutation in a north European family.

PMID 1634368 1992 Three beta-thalassemia mutations in the Japanese: IVS-II-1 (G----A), IVS-II-848 (C----G), and codon 90 (GAG----TAG).

PMID 8718703 1995 Molecular analyses of beta-thalassemia in Iran.

PMID 12144057 2002 Beta-thalassemia intermedia from southern Iran: IVS-II-1 (G-->A) is the prevalent thalassemia intermedia allele.

PMID 1971109 1990 Molecular basis for dominantly inherited inclusion body beta-thalassemia.

PMID 10367791 1999 Potential of denaturing gradient gel electrophoresis for scanning of beta-thalassemia mutations in India.

PMID 1177278 1975 Homozygous haemoglobin D Punjab.

PMID 2563949 1989 One form of inclusion body beta-thalassemia is due to a GAA----TAA mutation at codon 121 of the beta chain.

PMID 8161774 1994 Nonsense codon mutations in the terminal exon of the beta-globin gene are not associated with a reduction in beta-mRNA accumulation: a mechanism for the phenotype of dominant beta-thalassemia.

PMID 24080465 2013 Spectrum of β-thalassemia mutations in Guizhou Province, PR China, including first observation of codon 121 (GAA>TAA) in Chinese population.

PMID 3557998 1986 A note about the incidence and origin of Hb D-Punjab in Xinjiang, People's Republic of China.

PMID 3014870 1986 Characterization of a spontaneous mutation to a beta-thalassemia allele.

PMID 25849334 2015 Genetic heterogeneity of the β-globin gene in various geographic populations of Yunnan in southwestern China.

PMID 4078867 1985 The first observation of Hb D Punjab beta zero thalassaemia in an English family with 22 cases of unsuspected beta zero thalassaemia minor among its members.

PMID 26877226 2017 Prevalence and genetic analysis of α- and β-thalassemia in Baise region, a multi-ethnic region in southern China.

PMID 1517108 1992 Two beta-thalassemia mutations in Japan: codon 121 (GAA----TAA) and IVS-I-130 (G----C).

PMID 9875660 1998 Phenotype variability of the dominant beta-thalassemia induced in four Dutch families by the rare cd121 (G-->T) mutation.

PMID 8978308 1997 Erythroblastic inclusions in dominantly inherited beta thalassemias.

PMID 5672850 1968 Hemoglobin D Los Angeles in two Caucasian families: hemoglobin SD disease and hemoglobin D thalassemia.

PMID 2207008 1990 Isolation and characterization of the translation product of a beta-globin gene nonsense mutation (beta 121 GAA----TAA).

PMID 22675570 2012 Unspliced precursors of NMD-sensitive β-globin transcripts exhibit decreased steady-state levels in erythroid cells.

PMID 28671035 2017 Molecular Characterization of β-Thalassemia Mutations in Central Vietnam.

PMID 17278112 2007 Hemoglobin SE disease: a concise review.

PMID 7395858 1980 Homozygous hemoglobin E mimics beta-thalassemia minor without anemia or hemolysis: hematologic, functional, and biosynthetic studies of first North American cases.

PMID 24368026 2014 Hemoglobin Constant Spring is markedly high in women of an ethnic minority group in Vietnam: a community-based survey and hematologic features.

PMID 8735302 1996 ACOG technical bulletin. Hemoglobinopathies in pregnancy. Number 220--February 1996 (replaces no. 185, October 1993). Committee on Technical Bulletins of the American College of Obstetricians and Gynecologists.

PMID 1974422 1990 Molecular basis of HbE-beta-thalassemia and the origin of HbE in northeast Thailand: identification of one novel mutation using amplified DNA from buffy coat specimens.

PMID 7177196 1982 Abnormal RNA processing due to the exon mutation of beta E-globin gene.

PMID 6572978 1983 """Silent"" nucleotide substitution in a beta+-thalassemia globin gene activates splice site in coding sequence RNA."

PMID 25905082 2015 Tetra-Primer ARMS PCR Optimization for Detection of IVS-II-I (G-A) and FSC 8/9 InsG Mutations in β-Thalassemia Major Patients in Isfahan Population.

PMID 2001456 1991 Molecular characterization of beta-thalassemia intermedia in patients of Italian descent and identification of three novel beta-thalassemia mutations.

PMID 2393712 1990 A new mutation at IVS1 nt 2(T----A), in beta-thalassemia from Algeria.

PMID 25677748 2015 Broader spectrum of β-thalassemia mutations in Oman: regional distribution and comparison with neighboring countries.

PMID 19843386 2009 Molecular variants and clinical importance of beta-thalassaemia traits found in the state of Orissa, India.

PMID 26410419 2016 [Symptomatic extramedullary haematopoiesis in β-thalassemia: A retrospective single centre study].

PMID 23665927 2013 Molecular characterization of β-thalassemia in four communities in South Gujarat--codon 30 (G → A) a predominant mutation in the Kachhiya Patel community.

PMID 25976460 2015 Genotype-phenotype correlation and report of novel mutations in β-globin gene in thalassemia patients.

PMID 12210807 2002 Spectrum of beta-thalassemia mutations and their association with allelic sequence polymorphisms at the beta-globin gene cluster in an Eastern Indian population.

PMID 22738610 2012 Hb E/β-thalassemia: the second most common cause of transfusion-dependent thalassemia in the Gwalior-Chambal region of Central India.

PMID 18056002 2007 Missense mutation of the last nucleotide of exon 1 (G->C) of beta globin gene not only leads to undetectable mutant peptide and transcript but also interferes with the expression of wild allele.

PMID 2915972 1989 A 5' splice-region G----C mutation in exon 1 of the human beta-globin gene inhibits pre-mRNA splicing: a mechanism for beta+-thalassemia.

PMID 21931510 2011 Combination of two rare mutations causes β-thalassaemia in a Bangladeshi patient.

PMID 15257926 2004 The molecular basis of beta-thalassemia in Argentina. Influence of the pattern of immigration from the Mediterranean Basin.

PMID 12488606 2001 The Spectrum of beta-Thalassemia Mutations in the Arab Populations.

PMID 7615400 1995 Compound heterozygosity for two beta chain variants: Hb S [beta 6(A3)Glu-->Val] and the high affinity variant Hb San Diego [beta 109(G11)Val-->Met].

PMID 4808644 1974 Hemoglobinopathic erythrocytosis due to a new electrophoretically silent variant, hemoglobin San Diego (beta109 (G11)val--met).

PMID 23859443 2013 Molecular study of congenital erythrocytosis in 70 unrelated patients revealed a potential causal mutation in less than half of the cases (Where is/are the missing gene(s)?).

PMID 3957694 1986 Hemoglobin San Diego/beta zero thalassemia in a Greek adult.

PMID 18818920 2009 Haemoglobinopathies with high oxygen affinity. Experience of Erythropathology Cooperative Spanish Group.

PMID 24369358 2014 Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah.

PMID 6585831 1984 beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects.

PMID 20412082 2010 Molecular epidemiological survey of haemoglobinopathies in the Guangxi Zhuang Autonomous Region of southern China.

PMID 16206199 2006 Impact of a national beta-thalassemia carrier screening program on the birth rate of thalassemia major.

PMID 9450794 1998 Beta-thalassaemia intermedia: is it possible consistently to predict phenotype from genotype?

PMID 16044458 2005 Nucleotide -88 (C-T) promoter mutation is a common beta-thalassemia mutation in the Jat Sikhs of Punjab, India.

PMID 1634236 1992 Novel promoter and splice junction defects add to the genetic, clinical or geographic heterogeneity of beta-thalassaemia in the Portuguese population.

PMID 8199027 1994 The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci.

PMID 1390250 1992 The beta-thalassaemia mutations in the population of Cyprus.

PMID 2775294 1989 Abnormal processing of beta-Malay globin RNA.

PMID 3006832 1986 Use of oligonucleotide hybridization in the characterization of a beta zero-thalassemia gene (beta 37 TGG----TGA) in a Saudi Arabian family.

PMID 23510507 2013 Identification of two rare β-globin gene mutations in a patient with β-thalassemia intermedia from Azerbaijan.

PMID 20395516 2010 Comprehensive and efficient HBB mutation analysis for detection of beta-hemoglobinopathies in a pan-ethnic population.

PMID 21797703 2011 Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.

PMID 7852087 1994 Molecular characterization of beta-thalassemia in north Jordan.

PMID 1520612 1992 High prevalence of the beta-thalassaemia nonsense 37 mutation in Catalonians from the Ebro delta.

PMID 4018033 1985 Thalassemia due to a mutation in the cleavage-polyadenylation signal of the human beta-globin gene.

PMID 22690826 2012 Variable haematological and clinical presentation of β-thalassaemia carriers and homozygotes with the Poly A (T→C) mutation in the Indian population.

PMID 1374896 1992 Two mutations in the beta-globin polyadenylylation signal reveal extended transcripts and new RNA polyadenylylation sites.

PMID 1705411 1990 Molecular studies of beta-thalassemia in Israel. Mutational analysis and expression studies.

PMID 25089872 2014 High resolution melting analysis: a rapid screening and typing tool for common β-thalassemia mutation in Chinese population.

PMID 8373896 1993 Hemoglobin E and codon 17 nonsense: two beta-globin gene mutations common in Southeast Asia detected by the use of ARMS.

PMID 88735 1979 beta 0 thalassemia, a nonsense mutation in man.

PMID 20035706 2010 Preimplantation genetic diagnosis of beta-thalassemia using real-time polymerase chain reaction with fluorescence resonance energy transfer hybridization probes.

PMID 24857915 2014 Molecular characterization of α- and β-thalassaemia among Malay patients.

PMID 1517110 1992 A novel frameshift mutation: deletion of C in codons 74/75 of the beta-globin gene causes beta zero-thalassemia in a Turkish patient.

PMID 11480785 2001 Genetic heterogeneity of beta-thalassemia at Cukurova in southern Turkey.

PMID 8257991 1993 Identification of two novel beta zero-thalassemia mutations in a Filipino family: frameshift codon 67 (-TG) and a beta-globin gene deletion.

PMID 27263053 2016 The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population.

PMID 17900295 2007 The clinical significance of the spectrum of interactions of CAP+1 (A-->C), a silent beta-globin gene mutation, with other beta-thalassemia mutations and globin gene modifiers in north Indians.

PMID 3683554 1987 Characterization of beta-thalassaemia mutations using direct genomic sequencing of amplified single copy DNA.

PMID 2875755 1986 The spectrum of beta-thalassemia genes in China and Southeast Asia.

PMID 23383304 2013 Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China.

PMID 6585381 1984 Pathological effects of sickle cell anemia on the pulp.

PMID 2014803 1991 The spectrum of beta-thalassemia mutations in Taiwan: identification of a novel frameshift mutation.

PMID 23651435 2013 Mild β(+)-thalassemia associated with two linked sequence variants: IVS-II-839 (T>C) and IVS-II-844 (C>A).

PMID 26041423 2015 Very mild forms of Hb S/beta(+)-thalassemia in Brazilian children.

PMID 7819068 1994 Homozygous beta-thalassaemia resulting in the beta-thalassaemia carrier state phenotype.

PMID 17565724 2007 Sickle liver disease--an unusual presentation in a compound heterozygote for HbS and a novel beta-thalassemia mutation.

PMID 21119755 2009 Profiling β-thalassaemia mutations in India at state and regional levels: implications for genetic education, screening and counselling programmes.

PMID 20113284 2010 Hemoglobinopathies in North Africa: a review.

PMID 19254853 2009 Regional heterogeneity of beta-thalassemia mutations in the multi ethnic Indian population.

PMID 3457470 1986 Fine structure genetic analysis of a beta-globin promoter.

PMID 19372376 2009 Upstream open reading frames cause widespread reduction of protein expression and are polymorphic among humans.

PMID 3021607 1986 "The same ""TATA"" box beta-thalassemia mutation in Chinese and US blacks: another example of independent origins of mutation."

PMID 26079343 2015 Spectrum of α-thalassemia and β-thalassemia mutations in the Guilin Region of southern China.

PMID 11559932 2001 Spectrum of beta-thalassemia in Jordan: identification of two novel mutations.

PMID 27453201 2016 Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East.

PMID 19488752 2009 A novel beta-globin mutation (HBB:c.107A>G; or codon 35 beta (A-->G)) at alpha-beta chain interfaces.

PMID 22875618 2013 β Thalassemia major due to acquired uniparental disomy in a previously healthy adolescent.

PMID 1581247 1992 A novel beta zero-thalassaemia mutation (codon 15, TGG----TGA) is prevalent in a population of central Portugal.

PMID 25617386 2015 β-Globin Mutations in Egyptian Patients With β-Thalassemia.

PMID 17486505 2007 Molecular basis of beta-thalassemia and other hemoglobinopathies in Bulgaria: an update.

PMID 2606727 1989 Frameshift codon 5 [Fsc-5 (-CT)] thalassemia; a novel mutation detected in a Greek patient.

PMID 9225979 1997 Regional distribution of beta-thalassemia mutations in India.

PMID 1515453 1992 Identification of five rare mutations including a novel frameshift mutation causing beta zero-thalassemia in Thai patients with beta zero-thalassemia/hemoglobin E disease.

PMID 8889595 1996 New frameshift mutation, insertion of A, at codon 95 of the beta-globin gene causes beta-thalassemia in two Vietnamese families.

PMID 8874232 1996 beta-Thalassemia mutation at -90C-->T impairs the interaction of the proximal CACCC box with both erythroid and nonerythroid factors.

PMID 14555318 2003 A rare beta-thalassaemia mutation (C-T) at position -90 of the beta-globin gene discovered in a Chinese family.

PMID 18076350 2008 A family with multiple mutations and sequence variations in the alpha- and beta-globin gene clusters.

PMID 18339318 2008 Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes.

PMID 6264477 1981 Base substitution in an intervening sequence of a beta+-thalassemic human globin gene.

PMID 6264391 1981 An intron nucleotide sequence variant in a cloned beta +-thalassaemia globin gene.

PMID 1967205 1990 Beta-thalassemia genes in French-Canadians: haplotype and mutation analysis of Portneuf chromosomes.

PMID 8330981 1993 IVS-I-1 (G-->C) in combination with -42 (C-->G) in the promoter region of the beta-globin gene in patients from Tajikistan.

PMID 1586746 1992 Dominant thalassemia-like phenotypes associated with mutations in exon 3 of the beta-globin gene.

PMID 1728311 1992 Mean corpuscular volume of heterozygotes for beta-thalassemia correlates with the severity of mutations.

PMID 3417300 1988 Substitution of proline for leucine at position 110 in the G-helix of the beta-globin chain greatly reduced the molecular stability of the beta-globin subunit, leading to total destruction of the variant globin chains by proteolysis and hence to the beta-thalassemia phenotype.

PMID 18495504 2008 Hb Showa Yakushiji [beta 110 (G12) Leu-->Pro] in 3 families from Western India: first report on homozygous Hb Showa Yakushiji.

PMID 15768552 2005 Hb Showa-Yakushiji [beta110(G12)Leu-->Pro] in four unrelated patients from west Bengal.

PMID 2005117 1991 Hemoglobin Terre Haute arginine beta 106. A posthumous correction to the original structure of hemoglobin Indianapolis.

PMID 10520021 1999 Is it dominantly inherited beta thalassaemia or just a beta-chain variant that is highly unstable?

PMID 2822177 1987 A novel globin structural mutant, Showa-Yakushiji (beta 110 Leu-Pro) causing a beta-thalassemia phenotype.

PMID 2897787 1988 Determination of the spectrum of beta-thalassemia genes in Spain by use of dot-blot analysis of amplified beta-globin DNA.

PMID 9560205 1998 Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs.

PMID 6280138 1982 Five nucleotide changes in the large intervening sequence of a beta globin gene in a beta+ thalassemia patient.

PMID 6298782 1983 Abnormal splice in a mutant human beta-globin gene not at the site of a mutation.

PMID 22122796 2012 Effect of co-inheritance of β-thalassemia and hemochromatosis mutations on iron overload.

PMID 6733281 1984 Abnormal processing of beta Knossos RNA.

PMID 9340427 1997 [Beta thalassemia in Germany: molecular genetics and clinical phenotype in immigrant and in the native population].

PMID 2291577 1990 Beta-thalassemia intermedia in Turkey.

PMID 17949282 2007 Combination of Hb Knossos [Cod 27 (G-T)] and IVSII-745 (C-G) in a Turkish patient with beta-thalassemia major.

PMID 7104238 1982 'Silent' beta-thalassaemia caused by a 'silent' beta-chain mutant: the pathogenesis of a syndrome of thalassaemia intermedia.

PMID 15481885 2004 Contribution to the description of the beta-thalassemia spectrum in Tunisia and the origin of mutation diversity.

PMID 3780671 1986 Beta zero thalassemia caused by a base substitution that creates an alternative splice acceptor site in an intron.

PMID 6985481 1981 Nonsense and frameshift mutations in beta 0-thalassemia detected in cloned beta-globin genes.

PMID 22110956 2010 β-Thalassemia Mutations among Transfusion-Dependent Thalassemia Major Patients in Northern Iraq.

PMID 22851993 2012 β-Thalassemia mutations and hemoglobinopathies in Adana, Turkey: results from a single center study.

PMID 1850955 1991 A new frameshift beta zero-thalassemia mutation (codons 27-28 +C) found in a Chinese family.

PMID 21599435 2011 Molecular lesion frequency of hemoglobin gene disorders in Taiwan.

PMID 25000193 2014 Molecular epidemiological characterization and health burden of thalassemia in Jiangxi Province, P. R. China.

PMID 10776695 2000 Beta-thalassaemia intermedia in Lebanon.

PMID 3828533 1987 The molecular basis of beta-thalassemia in Lebanon: application to prenatal diagnosis.

PMID 9949622 1998 High incidence of the CD8/9 (+G) beta 0-thalassemia mutation in Spain.

PMID 21509314 2009 Screening of Five Common Beta Thalassemia Mutations in the Pakistani Population: A basis for prenatal diagnosis.

PMID 16821247 2006 Prenatal diagnosis of beta-thalassemia in Southern Punjab, Pakistan.

PMID 23348723 2013 Prediction of mutant mRNA splice isoforms by information theory-based exon definition.

PMID 16470532 2006 Identification of the four most common beta-globin gene mutations in Greek beta-thalassemic patients and carriers by PCR-SSCP: advantages and limitations of the method.

PMID 25856402 2015 First Detection of a Splice Site β-Thalassemia Mutation, IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in a Chinese Family.

PMID 11939510 2002 The beta+-IVS-I-6 (T-->C) mutation accounts for half of the thalassemia chromosomes in the Palestinian populations of the mountain regions.

PMID 7522523 1994 Possible factors influencing the haemoglobin and fetal haemoglobin levels in patients with beta-thalassaemia due to a homozygosity for the IVS-I-6 (T-->C) mutation.

PMID 26097845 2015 Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β -Globin Gene with the IVSI-6 Thalassemia Mutation.

PMID 6280057 1982 Linkage of beta-thalassaemia mutations and beta-globin gene polymorphisms with DNA polymorphisms in human beta-globin gene cluster.

PMID 1698102 1990 Observations on the levels of Hb A2 in patients with different beta-thalassemia mutations and a delta chain variant.

PMID 16987798 2006 Detection of two rare beta-thalassemia alleles found in the Tunisian population: codon 47 (+A) and codons 106/107 (+G).

PMID 13716727 1961 Thalassemia minor associated with hemoglobin-B2 heterozygosity. A family report.

PMID 2283303 1990 A novel frameshift mutation [FSC 47 (+A)] causing beta-thalassemia in a Surinam patient.

PMID 19205970 2009 Molecular heterogeneity of beta-thalassemia in Algeria: how to face up to a major health problem.

PMID 17486495 2007 Genotypic correlation between six common beta-thalassemia mutations and the XmnI polymorphism in the Moroccan population.

PMID 1769663 1991 Molecular heterogeneity of beta-thalassemia in mestizo Mexicans.

PMID 6310991 1983 beta-Thalassemia due to a deletion of the nucleotide which is substituted in the beta S-globin gene.

PMID 22188014 2012 Towards a prevention program for β-thalassemia. The molecular spectrum in East Java, Indonesia.

PMID 27117567 2016 Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.

PMID 12752111 2003 The molecular basis for the thalassaemias in Sri Lanka.

PMID 21423179 2011 Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PMID 7599641 1995 Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T.

PMID 1301930 1992 A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms.

PMID 24880717 2014 Molecular diagnostics of the HBB gene in an Omani cohort using bench-top DNA Ion Torrent PGM technology.

PMID 17486493 2007 Three new beta-globin gene promoter mutations identified through newborn screening.

PMID 8112743 1994 Sickle cell anemia, sickle cell beta-thalassemia, and thalassemia major in Albania: characterization of mutations.

PMID 1856830 1991 Homozygous beta+ thalassaemia owing to a mutation in the cleavage-polyadenylation sequence of the human beta globin gene.

PMID 2375910 1990 Two novel polyadenylation mutations leading to beta(+)-thalassemia.

PMID 7909640 1994 Binding of nuclear factors to the proximal and distal CACCC motifs of the beta-globin gene promoter: implications for the -101 (C-->T) 'silent' beta-thalassemia mutation.

PMID 7683931 1993 A promoter mutation of the beta-globin gene (-101 C-->T) has an age-related expression pattern.

PMID 8980256 1997 Genetic analysis of beta-thalassemia intermedia in Israel: diversity of mechanisms and unpredictability of phenotype.

PMID 8172199 1994 Genotype of subjects with borderline hemoglobin A2 levels: implication for beta-thalassemia carrier screening.

PMID 2713503 1989 "A C----T substitution at nt--101 in a conserved DNA sequence of the promotor region of the beta-globin gene is associated with ""silent"" beta-thalassemia."

PMID 19657836 2009 Three new beta-thalassemia mutations with varying degrees of severity.

PMID 18096416 2008 The molecular heterogeneity of beta-thalassemia in Greece.

PMID 18603555 2008 Significance of borderline hemoglobin A2 values in an Italian population with a high prevalence of beta-thalassemia.

PMID 2346726 1990 The C-T substitution in the distal CACCC box of the beta-globin gene promoter is a common cause of silent beta thalassaemia in the Italian population.

PMID 11857746 2002 Reliability of DHPLC in mutational screening of beta-globin (HBB) alleles.

PMID 17145605 2006 Analysis of delta-globin gene alleles in the Sicilian population: identification of five new mutations.

PMID 10606872 1999 Molecular, haematological and clinical studies of the -101 C --> T substitution of the beta-globin gene promoter in 25 beta-thalassaemia intermedia patients and 45 heterozygotes.

PMID 23812938 2013 South-Italy β°-thalassemia: a novel deletion not removing the γ-globin silencing element and with 3' breakpoint in a hsRTVL-H element, associated with β°-thalassemia and high levels of HbF.

PMID 11570721 2001 The beta-thalassemia mutation spectrum in the Iranian population.

PMID 6101206 1981 Unstable beta-globin mRNA in mRNA-deficient beta o thalassemia.

PMID 6292840 1982 mRNA-deficient beta o-thalassemia results from a single nucleotide deletion.

PMID 1545796 1992 Nonsense codons in human beta-globin mRNA result in the production of mRNA degradation products.

PMID 9113933 1997 Prevalence and genotypes of alpha- and beta-thalassemia carriers in Hong Kong -- implications for population screening.

PMID 26290351 2015 Molecular Epidemiological Investigation of Thalassemia in the Chengdu Region, Sichuan Province, Southwest China.

PMID 6826539 1983 Structural analysis of a beta-thalassemia gene found in Taiwan.

PMID 24200214 2014 Coexistence of two β-globin gene deletions in a Chinese girl with β-thalassemia minor.

PMID 25135424 2015 Variable phenotypes of sickle cell disease in India with the Arab-Indian haplotype.

PMID 15181845 2004 [Genetic study on 27 children with beta-thalassemia major and their parents in Sichuan area].