Variant: rs148149124

present in Gene: TUBGCP4 present in Chromosome: 15 Position on Chromosome: 43382233 Alleles of this Variant: TAAAAGAAAAA/-;TAAAAGAAAAATAAAAGAAAAA

rs148149124 in TUBGCP4 gene and High density lipoprotein measurement PMID 30275531 2018 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.

rs148149124 in TUBGCP4 gene and Triglycerides measurement PMID 30275531 2018 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.